Creation: The Origin of Life / The Future of Life

Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives.
'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday
The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, offering answers to the very grandest of questions before arriving at a thrilling solution.
'A superbly written explanation' Brian Cox
This same science has led to a technological revolution: the ability to create entirely new life forms within the lab, known as synthetic biology. The Future of Life introduces these remarkable innovations, explains how they work, and presents a powerful argument for their benefit to humankind.
'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating.' Sunday Telegraph
'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer
'The perfect primer on the past and future of DNA' Guardian
'Susenseful, erudite and thrilling' Prospect
'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain
'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili
'A fascinating glimpse into our past and future. Rutherford argues persuasively against those who seek to hold back scientific progress. His illuminating book is full of optimism about what we might be able to achieve' Sunday Times
'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk
'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts
'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome
'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times
Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book.
TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG

Science & Math

ADAM RUTHERFORD

Biological Sciences

Penguin

A Brief History of Everyone Who Ever Lived: The Stories in Our Genes

This is a story about you. It is the history of who you are and how you came to be. It is unique to you, as it is to each of the 100 billion modern humans who have ever drawn breath. But it is also our collective story, because in every one of our genomes we each carry the history of our species - births, deaths, disease, war, famine, migration and a lot of sex. Since scientists first read the human genome in 2001 it has been subject to all sorts of claims, counterclaims and myths. In fact, as Adam Rutherford explains, our genomes should be read not as instruction manuals, but as epic poems. DNA determines far less than we have been led to believe about us as individuals, but vastly more about us as a species. In this captivating journey through the expanding landscape of genetics, Adam Rutherford reveals what our genes now tell us about history, and what history tells us about our genes. From Neanderthals to murder, from redheads to race, dead kings to plague, evolution to epigenetics, this is a demystifying and illuminating new portrait of who we are and how we came to be.

Evolution

orion#

The Book of Humans: The Story of How We Became Us

Weidenfeld&Nicolson

In Rutherford and Fry’s comprehensive guidebook, they tell the complete story of the universe and absolutely everything in it – skipping over some of the boring parts. This is a celebration of the weirdness of the cosmos, the strangeness of humans and the fact that amid all the mess, we can somehow make sense of life.\nOur brains have evolved to tell us all sorts of things that feel intuitively right but just aren’t true: the world looks flat, the stars seem fixed in the heavenly firmament, a day is 24 hours… This book is crammed full of tales of how stuff really works. With the power of science, Rutherford and Fry show us how to bypass our monkey-brains, taking us on a journey from the origin of time and space, via planets, galaxies, evolution, the dinosaurs, all the way into our minds, and wrestling with some truly head-scratching questions that only science can answer:\nWhat is time, and where does it come from? 
Why are animals the size and shape they are? 
What is a thought? 
How horoscopes work (Spoiler: they don’t, but you think they do) 
Does my dog love me? 
Why nothing is truly round 
Do you need your eyes to see?

RUTHERFORD AND FRY?S COMPLETE GUIDE TO A

Creation

Penguin/Viking

The Science and Christian message of the Great Pyramid revealing the Devine Plan for Our Planet

Pyramidology - Book 1

The Institute of Pyramidology

Iceland's Great Inheritance

Artisan Publishers

Another rare and exciting discovery by Artisan Publishers - A long out of print Adam Rutherford 1934 Classic - an explanation of the origin, function and destiny of the Anglo-Celto-Saxon Race in the British Empire and U.S.A.! Adam Rutherford best known for his authoritative and highly respected works showing the connection between Bible prophecy and the Great Pyramid wrote in 1934 Israel - Britain an exciting historical account of the movements over the centuries and final destination of the so-called "Lost Tribes of Israel." The following is an excerpt from Israel - Britain this very important contribution by Adam Rutherford which Artisan Publishers is pleased to make available for its readership: After the Declaration of Independence on 4th July 1776 when the separation from the British Empire took place the U.S.A. of 13 original states gradually expanded right across the North American Continent from the Atlantic to the Pacific and to-day America is the largest civilized nation on the face of the globe. How amply fulfilled is the promise to the Patriarch Manasseh that he would become "a great people." . . . America conjointly with Britain has a very important and noble part to perform in the affairs of humanity in the near future; this we discuss in later chapters. . . . "Israel-Britain written in 1934 by Dr. Adam Rutherford is a timeless revelation of prophecy. I recommend this book which shows the fulfillment of the Abrahamic Covenant made 4000 years ago by the Almighty." - E. Raymond Capt Paperback (Abridged Edition) 220 pages

Israel-Britain : Or Anglo-Saxon Israel

Artisan Publishers (1982)

Faster, Stronger, Smarter: The Dark History and Troubling Present of Eugenics

Control

See the best price to sell, buy, or rent books by ADAM RUTHERFORD. BookScouter helps to compare book prices from 25+ online bookstores and 30+ buyback vendors with a single search.

Books by ADAM RUTHERFORD